cinelewis5751 cinelewis5751

07-12-2022
Mathematics

contestada

if nominal gdp is $9,600 billion and the gdp deflator is 118.5, real gdp is

Respuesta :

Otras preguntas

Form the intersection for the following sets. R = {10, 15, 20) S = {20, 25) ROS= Ol) (10, 15, 25) O (20) (10, 15, 20, 25)

What is the measure of the x? DO NOT ANSWER IF YOU DO NOT THE ANSWER! Whoever answers correctly will get Brainliest! :)

A company has won an important government contract. Several employees have been transferred from their existing projects to support a new contract. Some of the

Question 1 of 10 What are the possible responses? -- Bonjour Monsieur, permettez-moi de vous présenter Madame Dubois. A. Je suis très heureux de vous rencontrer

y +3 +1 1 -2 -3 Mark all the statements that are true. A. This graph is not a function because the value x = 3 is assigned to more than one y-value. B. The equa

Help me please with this math question! giving brainliest to the correct answer

Helppp plssss 2 questions

In the telemarketing industry, one successful sale in one hundred calls is considered success. That is, the probability of success is 1/100 and the probability

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Identity the following on the wave shown below: Amplitude: V, Wavelength I neeed help pleaseeeee asap