ailani9 ailani9

06-06-2023
Biology

contestada

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Respuesta :

Otras preguntas

3 frogs jumped a total of 115 centimeters how much did each frog jump

How are bones similar to rocks and how are they different?

Which equation has both a liquid and a gas as products

Which renewable resource could become a non renewable resource if used faster than Earth ability to.replenish it's supply?

2. Which words are the first and last words of the participial phrase in this sentence? We went over the whole chapter, beginning with the first page. A. went

What's the square root of 19

Find the diameter of a cone that has a volume of 104.67 cubic inches and a height of 4 inches. Use 3.14 for pi. 4 inches 6 inches 8 inches 10 inches

The ___________ River forms part of the border between the united States and Canada. A. Mississippi B. St. Lawwrence C. Rio Grande

Solve 20x+5y=15 for y

This rectangle has an area of x^2-15x+56 and a length of x-7 meters. What expression represents the width of the rectangle? Width = ____ meters. Please help! Th