TheLegendYT
TheLegendYT TheLegendYT
  • 11-01-2024
  • Biology
contestada

This is a question about Biology, I need help
Pls answer the Best as you can

Write the base pairs that go on the opposite strand
BUILD A DNA STRAND
(remember the base pairs)

TTAAGCGGTTAAGCATTGCGGGCAAT

Respuesta :

Otras preguntas

multiply, (x+4)(x-4)  simplify answer.
what is the intercept? what is the slope? y+2=9
Write 4 7/16 as an equivalent decimal.
Magic squares when added all rows & columns equal the same #, such as the example on q #7. I need Question #8 . Please help
How do heavy sediment deposits affect waterways
A really simple question that I just don't understand.
What is experimental probability?
Convert 59°c to farenheit
Differentiate the following functions y=4x^3-2x^2+5x^-3.7-6
the book The Outsider question why does Dally want Ponyboy to be tough and hard like him rather than be like Johnny? Do you think Dally believes his own advic