devilishdylan4933 devilishdylan4933

07-02-2024
Mathematics

contestada

What is the exact value of the trigonometric expression in simplest form?
Tan (2n/3) +4cos (11n/6)
A. -213
B. V3
C. -V3
D. 2V3

Respuesta :

Otras preguntas

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Was the New Deal a Success or Failure? give one reason why and why not IF U DONT KNOW DONT ANSWER AND DONT COPY AND PASTE

PLEASE HELP ASAP!! CORRECT ANSWER ONLY PLEASE!!! Which expense can be paid for with a flexible spending account (FSA)? A. car insurance deductible B. child care

Using a print source (such as a newspaper or magazine) or the Internet, find visual examples of each of the logical fallacies, that is, advertisements with a pi

Pls answer as fast as you can I will give brainliest and 30 points

The process of transporting materials in a cell involves a positive change in the amount of free energy in the cell. Which of the following best describes how t

solve for x. please help with this problem i am really bad at geometry!! will give thanks

Maribel y Enrique van a una tienda y combinan ropa de muchos colores. Pregúntale a otro(a) estudiante quién lleva la ropa que describes. (Ask a partner about Ma

how many miles of a gas at 100 c does it take to fill a 1.00 l flask to a pressure of 152kPa

1/4 and 5/12 with common denominator