jasminestewart5142 jasminestewart5142

06-04-2024
Biology

contestada

Of the DNA sequences below, which would probably be the harder to determine?
a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA
b) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA

Respuesta :

Otras preguntas

Suppose you deposit $4000 in a savings account that pays interest at an annual rate of 3.1% compounded continuously How many years will it take for the balance

How does the amount of sugar affect the carbon dioxide production in yeast?

Find the total area in the picture. Round to the nearest tenths place.

Match each question or statement with a logical response

Which of the following is an example of a rational function?

name a character in Frankenstein who is described as hideous?

Blossom corporation recently reported an EBITDA of $29. 3 million and net income of $9. 7 million. The company had $6. 9 million interest expense, and it's aver

The owners of an eyeglass store claim that they fill customers' orders, on average, in 60 minutes with a standard deviation of 15. 9 minutes. Based on a random

4a + (-1.2b) + (-3a) + 7.9b

275 miles on 14 gallonspls hurry