brielleqween brielleqween

07-03-2016
Mathematics

contestada

Express 8 inches as a fraction of 3 feet in lowest terms.

Respuesta :

rdavies12 rdavies12

20-03-2016

There are twelve inches in a foot. So therefore 3 feet is 36 inches. So your fraction is 8/36, which can be simplified to 2/9.

Answer Link

Otras preguntas

Find m∠PQW if m∠WQR = 130°, m∠PQR = 16x, and m∠PQW = 3x.

After all of the account balances have been extended to the Income Statement columns of the work sheet, the totals of the Debit and Credit columns are $75,000 a

This is for a 5th grade worksheet* Do you think it was moral for European nations to claim lands in the americas that were already inhabited by the natives.

Ramona is filling window box planters that will be sold to benefit a local charity. She has 56 pansies, 42 tulips, and 28 marigolds. What is the greatest numb

Which word correctly completes the sentence? Son las siete de la noche y tengo mucha hambre. Quiero comer pollo para ______. la cena el almuerzo el desayuno

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

How much faces does a sphere have?

If we have a one-electron atom, and the electron can occupy any of 5 different energy levels, and transitions are possible between any level and any other, how

According to Hund's rule of maximum spin multiplicity, how many singly-occupied orbitals are there in the valence shells of the following elements in their grou

On his lunch break, Calvin purchases a burger and drink. The total order is $8.50, of which $1.08 is tax. How much was calvins meal before tax?