dolzz
dolzz dolzz
  • 10-09-2018
  • Mathematics
contestada

What is the answer how did you get the answer

What is the answer how did you get the answer class=

Respuesta :

bserna
bserna bserna
  • 10-09-2018

The artist will need 24 tan tiles. This is because 16 divided by 2 is 8, and 3 times 8 is 24.

Answer Link
brodtfamily4
brodtfamily4 brodtfamily4
  • 10-09-2018

The answer is 24. Hope it helps

Answer Link

Otras preguntas

Differences in which property allows the separation of a sample of sand and sea water by filteration
y=2x-1 3y=6x-5 Please help
the dogs of the girls Which is the correct way to rewrite this phrase? A. the girls’s dogs B. the girls dogs C. the girls’ dogs D. the girls’es dogs
Hey can you please help me posted picture of question
How did governments pay for the war ww1?
Kia's math test scores are shown. In order to join the math club she must have at least an 80 test score. What is the minimum score that she must make on her n
Which choice below explains why Arthur Miller wrote The Crucible?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
How does the idiom "Think Globally, Act Locally" continue to be useful for present-day environmentalism?        A. The lack of government solutions for global w
im confused on this please help