zitterkoph
zitterkoph zitterkoph
  • 10-09-2018
  • Mathematics
contestada

Which is the correct solution to the expression 3 + 5^2?

Respuesta :

suspho
suspho suspho
  • 10-09-2018

3 + 5² =

3 + 25 =

28 (your answer)

Answer Link

Otras preguntas

A portion of a hiking trail slopes upward at about a 6 degree angle. To the nearest tenth of a foot, what is the value of x, the hiker's change in vertical posi
Help me..... please.....
Choose three of the six critical thinking skills that would be most useful in your own life right now. State why. Answer in a WELL-DEVELOPED paragraph.
Why did china and india react differently to the western challenge his 112?
In 1918, the temperature in Alaska dropped from 52 degrees to -23 degrees in 15 hours. What was the average hourly change in temperature?
please help with 4, 6, 7 and 8:)
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
The gulf of tonkin resolution (1964) provided congressional support for
what are the two types of cases where the supreme court has original jurisdiction
10 Points Please Help ASAP!! How were the abolitionist movement and suffrage movement related?