prosier47 prosier47

08-11-2018
Biology

contestada

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Respuesta :

taylorskyrme taylorskyrme

19-11-2018

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine

Answer Link

Otras preguntas

Evaluate -x-4y when x=-7 And Y=5

Which two lines in this excerpt from Shakespeare's Romeo and Juliet forshadow the tragic fate of Romeo and juliet?

The combustion of 0.25 mol of an unknown organic compound results in the release of 320 kJ of energy. Which of the compounds in the table could be the unknown c

Which benefit suggestions of United States and its citizens have the right and duty to spread democracy across the continent and feel the land from coast to coa

Help me !! for algebra :*(

What religious community was an early supporter of the abolitionist movement?

Technician A says that a vehicle may be considered non-drivable if the seat belt retractor is damaged from the collision. Technician B says that a vehicle may

what really caused the 2nd explosion of the Lusitania?

How do wetlands form

Please help!!!! Write a speech and then make an outline of it (the outline must have 3 main points and examples and details)