cvag720 cvag720
  • 08-05-2019
  • Mathematics
contestada

A store sells ladders.

• The retail price was a 40 percent markup over the manufacturer price.
• A month later, the store reduced the retail price of the ladder by
25 percent.

What percent markup is the new retail price over the manufacturer price?

Respuesta :

kobaltkomit1991
kobaltkomit1991 kobaltkomit1991
  • 08-05-2019

Answer:

40% - 25% = 15% markup remaining.

Hope this helps!

Answer Link

Otras preguntas

(3 multiple choice chemistry questions) Will give brainliest!!!! 1. You measure a tall tree to be 227 meters tall, how many millimeters is this? A. 227 mm B. 0
if the foreign exchange rate between U.S dollar and danish krone is 1:2.50 how many danish krones will you get for $5
In which type of boundary do earths plates move apart from each other A convergent B divergent C transform
Read each statement about natural rights. Then, decide if the statement is true or false. Government gives natural rights to people. Natural rights include lif
Talking, listening, and reacting non-verbally are all part of communicating
Percy plotted the points (5,6)
can someone help me with this one
Please help me out I need it soon
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
What did Richard Arkwright invent