Lilybugdancer08 Lilybugdancer08

06-02-2020
Chemistry

contestada

1) This is a type of plant that contains a system of water-carrying vessels (xylem) and sugar carrying vessels (phloem).

Respuesta :

trinitycobin108 trinitycobin108

11-02-2021

Answer: Vascular plant

Explanation:

Answer Link

Otras preguntas

Which of these is the most important cause of adult onset epilepsy? neurocysticercosis neurotoxoplasmosis primary amoebic meningoencephalitis African trypanosom

Which of the following serve as chemical signals between cells and stimulate a wide range of nonspecific defenses? cytokines antimicrobial peptides complement p

Which is the most diverse group of seedless vascular plants? the liverworts the horsetails the club mosses the ferns

The ________ lobe contains the visual cortex. frontal parietal temporal occipital

Calculate the number of grams of ammonium chloride that must be added to 2.00 L of a 0.500 M ammonia solution to obtain a buffer of pH = 9.20. Assume the volume

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

In a study of the accuracy of fast food drive-through orders, one restaurant had 34 orders that were not accurate among 391 orders observed. Use a 0.05 signifi

WILL GIVE BRAINLIST FOR RIGHT ANSWER

Find [g *h](x) and [h*g](x) . g(x) = 5x h(x) = –10x3 + 13x2 – 3x + 3 [g *h](x)= –50x3 + 65x2 – 15x + 15 [h*g](x) = –1250x3 + 325x2 – 15x + 15 [g *h](x) = –

New parents place a continuous stream of $5,000 per year into a college fund which has a continuously compounding interest rate of 0.8%. What will be the value