notnobodyzzzz notnobodyzzzz

06-03-2020
Mathematics

contestada

find the area of the parallelogram

D1=9
D2=15

find the area of the parallelogram D19 D215 class=

Respuesta :

alliejay5234 alliejay5234

06-03-2020

Answer:

A=135

Step-by-step explanation:

A=bh

A=(9)(15)

A=135

Answer Link

Otras preguntas

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Jason and Kyle both choose a number from 1 to 10 at random. What is the probability that both numbers are odd?

Hat were the goals of the early civil rights movement

In a marketing context, the acronym imc refers to __________. interactive media convergence internal marketing communications integrated marketing collaboration

GIVING 20 POINT AND BRAINLY What is the linear function equation that best fits the data set? yˆ=2x−1 yˆ=x+2 yˆ=x+1 yˆ=2x+1

radical republicans in Congress opposed President Lincoln's plan for reconstruction because they thought it was too

The first step in managing it security is to develop a _____ based on confidentiality, integrity, and availability. a. risk policy b. security policy c. thr

At the grocery store, an 8-inch cherry pie costs $4.39 and a similar 10-inch cherry pie cost $6.15. which is the better deal?

Multiply 4x 1/2. And 1/2 x3/4. Also 3/4 x1/3. Please need help with this

What is a space which is entirely devoid of matter called in science terms?