raibetika raibetika
  • 09-04-2020
  • Mathematics
contestada

What two numbers add to -2 Multiply to 20

Respuesta :

jadandacyayisenga
jadandacyayisenga jadandacyayisenga
  • 09-04-2020
The answer would be 1 times 20
Answer Link

Otras preguntas

Read the excerpt from "Keynote Address." Of course, expectations are rising, and they are rising faster than we in our imperfect world can fulfill them. The r
Proving Triangles congruent by ASA and AAS
The measure of how much profit the firm generates as well as how much profit certain aspects of the firm, including regions, channels, and customer segments con
Brent is a full-time exempt employee in Clark County, Indiana. He earns an annual salary of $55,800 and is paid semimonthly. He is married filing separately and
The narrator of the chapter on Jacquie Red Feather refers to the losses in Jacquie's life as "burn holes in her life" (99). What experiences or events have left
What are the speakers credentials in teaching with yes talks?
1/2% in decimal please give me my answer Also I AM NOT ASKING for 1/2 in decimal I am asking for 1/2 percent in decimal
How did nationalism impact and influence ww1
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA
At the end of every year you deposit $4,800 into an account that earns 8% interest per year. What will be the approximate balance in your account immediately af