cristaltejada8
cristaltejada8 cristaltejada8
  • 06-05-2020
  • Health
contestada

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

Respuesta :

iveracisneros98
iveracisneros98 iveracisneros98
  • 06-05-2020

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

Answer Link

Otras preguntas

Why were the early U.S. political parties formed?
Explain why an atom does not have a charge.
While the identity theory of mind (i.e., reductive materialism) states that there are more than a single set of physical states to which a given type of mental
For the year 2018, a company provides the following information: Amount 4,000 30,000 Description Budgeted output Budgeted raw materials to be used in pounds) Bu
HELP PLEASE!! The Powhatan Indians helped to revive the Jamestown colony by exchanging food for copper and __________ implements.
What is the molarity of 1.1 mol of sucrose in 3.7 L of solution
Tenet Engineering, Inc. operates two user divisions as separate cost objects. To determine the costs of each division, the company allocates common costs to the
What is the radius of Jupiter?
El rico folclor salvadoreño se basa sobre todo en sus extraordinarios recursos naturales. Por ejemplo, según una leyenda, las muertes que se producen en la lagu
solve the equation 8n - (5n + 4) = 2n =(simplify your answer.)(show your work.)​