jameria2094 jameria2094
  • 07-05-2020
  • Biology
contestada

The major effect of indoleacetic acid is to

Respuesta :

ryleemcollins1439
ryleemcollins1439 ryleemcollins1439
  • 14-05-2020

Answer:

stimulate cell growth

Explanation:

took it

Answer Link

Otras preguntas

A species of moth with an 11-inch-long tongue feeds on the nectar from a species of orchid with an 11-inch-long nectar tube. In the same way, the orchids depend
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
A seasonal index for a monthly series is about to be calculated on the basis of three years' accumulation of data. The three previous July values were 110, 150,
"Dream, Inc., has debt outstanding with a face value of $5 million. The value of the firm if it were entirely financed by equity would be $18 million. The compa
In what ways did the columbian exchange impact the physical and human geography patterns in America?
The majority of Australians live in
By age __________, illness and disease overtake accidents as the leading cause of death, and, statistically speaking, this is the first time this occurs since i
"Beatlemania" gripped the United States in the 1960s when the British rock group The Beatles performed; adoring fans screamed, sometimes fainted, and shouted ex
Will give Brainlist Write a brief description of Duell Park?
Create a Top Five list of events related to westward expansion that affected African Americans. Review the lesson for compromises and consequences to help make