121314giftedpa9q7w 121314giftedpa9q7w

07-05-2020
History

contestada

50 points please answer ASAP

How many years were in between the founding of Cuzco and the fall of the Incas to the Spanish?

238 years

372 years

Respuesta :

Jordinbsmith Jordinbsmith

07-05-2020

Answer:

90

Explanation:

Answer Link

Otras preguntas

If you rub a balloon on a piece of fabric or carpeting and then hold it against your head, your hair can stand on end. Why?

What molecule makes the trunk of a tree sturdy? O A. Disaccharide O B. Glucose O C. Cellulose O D. Fructose

what was jays treaty

Why did England feel vulnerable to attack at the end of the 19th century?

A Circle is centered at the point 5.4 and passes through the point 3.2 what is the equation?

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

A. "Entrepreneurs bear the risk of business decisions"."Entrepreneurs earn wages".C. Entrepreneurship is the work time and work effort that people devote to pro

5 x the sum of a number and 2 is less than the number x 8. Find the number

How and Why the brakes of a car gets much hotter than brakes of bicycle?

Human Resources Manager Isaac Bauer is researching case studies as he prepares an employee wellness workshop. An effective method of formal research is to searc