raushantiwari8294 raushantiwari8294

08-09-2020
Mathematics

contestada

10^2+12^2+14^2+......+26^2=??

Respuesta :

mhanifa mhanifa

18-09-2020

Answer:

3156

Step-by-step explanation:

Used formula:
(1² + 2² + 3² + ... + n²) =1/6*n(n + 1)(2n + 1)

--------

10²+12²+14²+......+26² =
(2*5)²+(2*6)² + (2*7)² + ... + (2*13)² =
4*(5²+6²+7²+...+13²) =
4*(1²+2²+...+13² - (1²+2²+3²+4²)) =
4*(1/6*13(13+1)(2*13+1) - (1+4+9+16)) =
4*(1/6*13*14*27- 30) =
4*(819 - 30) =
4*789 =
3156

Answer Link

Otras preguntas

Which family structure is the type to take in children on a temporary basis?

What was learned from john watson's "little albert" study? it is important to ignore the consideration of a child's mental health as long as the research is imp

Please help me.......

In which form of business is a single individual responsible for the repayment of any debts? proprietorship. corporation. partnership. family-run bu

Mr. Skinner has quit his job in order to look for another one Mr. Skinner

Who won the Presidential Election of 1920? Warren G. Harding

How do I answer the question?

Q #4 [tex] < 6 < 1 < 2 < 4[/tex]

what's the answer????????????????

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3