amorajones5243 amorajones5243
  • 08-09-2020
  • Mathematics
contestada

is 49 square root larger than 7.1 ?

Respuesta :

Аноним Аноним
  • 08-09-2020

Answer:

well the square root of 49 is 7 . so maybe this will help you.

Answer Link

Otras preguntas

Which of the following was an American territory until it was granted independence in 1946?
My sister is 14 Years old. My brother says that his age minus twelve is equal to my sisters age. how old is my brother **PLEASE EXPLAIN**
Nicholas wrote the steps below to simplify the fraction 20/30. Find his error and correct it. 20/30= 20÷5=4 30÷6=5
I NEED HELP WITH THIS Explain why gases condense when they are cooled.
Can rock undergo compression, tension, and shear stress all at once? Yes or No Explain.
Help with reflexive pronouns
Which of the following skills is most important in learning how to write a research paper?
To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D
Help to reaolve this problem?
x + 948 = 1238 what does "x" equal?? EXPLAIN