pnfombo
pnfombo pnfombo
  • 09-09-2020
  • Biology
contestada

Name 2 food items that fall under the LIPID category.

Respuesta :

marleigh29
marleigh29 marleigh29
  • 09-09-2020
Avacodos and Cheese Fall under LIPID
Answer Link
kpoptrashlife101
kpoptrashlife101 kpoptrashlife101
  • 09-09-2020

Answer:

fried food or like meats and milk/cheese i hope this could help

Explanation:

Answer Link

Otras preguntas

list two cell structures that are found in plant cells but not in animal cells
List two powers that are denied by the u.s. constitution to ohio's state government, but are exercised at the national level.
Who won the Presidential Election of 1920? Warren G. Harding
"Knowing how to use fire may have helped the early humans who left Africa 50,000 to 60,000 years ago to cope with colder conditions in Europe. It may also have
According to freud, what does the ego unconsciously use to avoid recognizing uncomfortable ideas or emotions?
Someone or something that produces a result is a a cause. b signal word. c relationship. d central idea.
What neurotransmitter systems do methylated amphetamines affect?
Marcel is affected by serious, persistent problems that involve relationships, aggression, fear, and depression. he is suffering from ________.
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Signs of fatigue while driving include __________. A. sore eyes and muscles B. lapses in short-term memory C. sore eyes, sore muscles, and lapses in short-term