araerae2005
araerae2005 araerae2005
  • 10-09-2020
  • Mathematics
contestada

what is 8/6 in it simplest form​

Respuesta :

sangamay
sangamay sangamay
  • 10-09-2020

Answer:

1.3 repeating

Step-by-step explanation:

Answer Link
therealxyeen
therealxyeen therealxyeen
  • 10-09-2020

Answer:

4/3

Step-by-step explanation:

divide fraction in half.

Answer Link

Otras preguntas

Which sentence is correct? A. Mr. Harris was our city’s-mayor-elect when he built his house here. B. Mr. Harris was our city’s mayor-elect when he built his h
plz answer my multiple choice question
Of the 103 people enrolled in mathematics class, 91% are present. How many are present?
write and solve an inequality for this situation. To honor 50 years of business, All Strikes Bowling is having an anniversary special. Shoes rent for $1.25 and
Outline the structure and purpose of the United Nations Security Council
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Is comprised of the crust and the upper most mantle?
Which system is BEST described by the functions listed below? 1. Gather internal and external sensory input 2. Process the input 3. Respond to the input A.
Which of the following is considered a secondary source? A) an oral history B) a personal essay C) a scientist field journal D) a news article
In a random sample survey of 80 students at Torrey’s middle school, 24 students said that math was their favorite subject. There are a total of 300 students at