sapodillasweetness sapodillasweetness

07-10-2020
History

contestada

A group of citizens who are not professional soldiers, but fight together for a united cause.

Respuesta :

chickenop chickenop

07-10-2020

Answer:

Vigilantes

Explanation:

Answer Link

Otras preguntas

The surface area for a rectangular prism with a square base is SA=2s^2+4sh. What is the surface area if s=3 and h=5?

household energy usage gizmo

What’s the volume pleassseee help

which of the following is equal to the rational expression.......

Explain how you think the circuits were lighting the light bulb

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Here’s what they are asking

Label the map to show how the northwest ordinance regulated slavery.

The relative locations of a swing set, a garden, and a sandbox in Gina's backyard are shown in the diagram. What is the distance between the sandbox and garden?

John Donne created which literary technique