Seudónimo Seudónimo
  • 09-10-2020
  • History
contestada

Someone help a not A btw

Someone help a not A btw class=

Respuesta :

Minimoni7
Minimoni7 Minimoni7
  • 09-10-2020
The answer is B!

Hope it helps!
Answer Link
bobismyname677 bobismyname677
  • 14-11-2020

Answer:

B

Explanation:

Answer Link

Otras preguntas

Luke is building a storage building and needs to have a slab of concrete poured. He knows the contractor charges an initial cost of $95 plus an additional $3.50
How did Edwin Hubble study the redshifting of light from nebulae?
Help me please easy 30pts
Blood viscosity is the thickness of the blood. So thinking with common sense, if the blood is thicker, will that cause the blood pressure to increase or decreas
At 0.0 degrees Celsius, a wire cable is 410.0000 meters in length. When the temperature increased to 30.0 degrees Celsius, the wire increased in length by 0.344
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
In a survey of 400 people, 42% reported pizza as their favorite meal. How many of the people like pizza?
Our school has 6 Grade and 786 students. What is the average number of students in each grade
What is the sum of 3
Yan has already finished 3/5 of the 45 math problems he was assigned today. Each math problem took him 1 4/5 of a minute to complete. If this pace continues, h