kaylinbrown27 kaylinbrown27

06-11-2020
Mathematics

contestada

Find the simple interest earned to the nearest cent for each principal, interest rate, and time.
$1,000, 2%, 9 months

Respuesta :

littleminegamer littleminegamer

06-11-2020

Answer:

1180 :)

Step-by-step explanation:

Answer Link

Otras preguntas

i need help in this quick

the civil war devastated which side of the economy ?

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

A food processor for $149.50 cash, or $5.00 down and $10.00 per month for 15 months

Let d(t) =6t^2 be the distance function, find the average velocity from (4, 4.1)

N aqueous solution of sodium hydroxide is standardized by titration with a 0.154 m solution of hydrochloric acid. if 17.5 ml of base are required to neutralize

Can someone help me.I need to write a poem about the origins of drill in the military, and it's purpose of it in the military and daily life.(I really need help

Why do moderate levels of disturbance result in an increase in community diversity? why do moderate levels of disturbance result in an increase in community div

What is the formula managers use to calculate their other expense costper guest? other expense (x) number of guests served = other expense cost perguest other e

What does a party have if it is adversely affected or suffering imminent harm???