09-11-2020
Mathematics

contestada

Round 1.6 to the nearest whole number

Respuesta :

Kiddobot Kiddobot

09-11-2020

Answer:

The Answer is 2

Step-by-step explanation:

The rule is 4 or less let it rest. 5 or more raise the score. 6 is greater than 5 so you raise it to two

Answer Link

isabellacarling isabellacarling

09-11-2020

2 hope it helps have a good day!

Answer Link

Otras preguntas

What was the answer in the us to the housing crisis after WWll

(10 POINTS) What is the importance of ecosystems in West Africa?

can someone help me on #1 and #2 please ?

The first time you refuse to submit to a breath, urine, or blood test, your license will be suspended for ________.

50% of babies are born female. olive wants to find probability that 20 or more of the 50 babies born today were female.we need to design a simulations .which ra

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Can somesome find some numbers that will look legit like I did them and fill out #1 and 2. Lesson 1.03 Baseline Results Mile Run/Walk Body Composition/BMI A

which plot element is the turning point in the conflict where the main character must make a decision or take cation that determines the direction of the story

At a local baseball game there are 3 hot dog vendors. collectively the vendors sold 1,700 hot dogs. if vendor a sold 456, vendor b sold 607, and vendor c sold 6

How does evolutionary change arise