kellenbell
kellenbell kellenbell
  • 10-12-2020
  • Chemistry
contestada

6.02 x 10^23 in standard form

Respuesta :

alexiadeleon34 alexiadeleon34
  • 10-12-2020
the answer to your question is 6.02e+23
Answer Link

Otras preguntas

Solving polynomial equations
30 points !!! which of these is not a type of color scheme autochromatic monochromatic colorless polychromatic
An architect is designing a building each floor will be 12 ft tall. Write an expression for the number of floors the building can have for a given building heig
The word conversely is used as a signal for _____. COMPARING CONTRASTING
A store has a 20% off sale on pants. With this discount, the price of one pair of pants before tax is 15.20. What is the original price of the pants?
20 points How did many Great Plains farmers react to the difficult growing conditions caused by the drought? A) They attempted to find other work in the Nort
Usually, specific authorization is required for all of the following except a. write-off of an uncollectible account receivable b.
Felix joins a local recreation center to play basketball. The recreation center charges a $20 annual fee, plus an additional $15 per month for usage of the bask
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m
Write an expression to represent the sum of 4 and the product of 3 and a number X