ashleygarcia090817 ashleygarcia090817

06-01-2021
Biology

contestada

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Respuesta :

homadison4 homadison4

09-01-2021

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer Link

Otras preguntas

An awful tempest mashed the air, The clouds were gaunt and few; A Black, as of a spectre's cloak, Hid heaven and earth from view. What sort of tone does th

what is the chemical reaction by which cells make polymers from monomers

what do scientists rely and draw on when they propse a hypothesis?

Dna is made up of a long series of nucleic acids. a predetermined sequence that contains the information to produce a specific protein is called a __________.

what is the central idea of pages 71&76 in Fahrenheit 451

What does the representation of the forest indicate according to lines 163-175? In wife’s tales

A credit card company has cheated one million cardholders out of 50 cents each. marlene, one of the defrauded cardholders, wants to sue the credit card company

droughts might cause people to _______

What characteristic of enzymes allows it to be highly specific in the reaction they catalyze

The perpendicular bisectors of sides AC and BC of △ABC intersect side AB at points P and Q respectively , and intersect each other in the exterior (outside) of