AlphaBurger45 AlphaBurger45

07-01-2021
Mathematics

contestada

-79=7x+3(4x-1)

If you answer this then you are officially smart

Respuesta :

isamarcoli isamarcoli

07-01-2021

Answer:

x = -4

Step-by-step explanation:

-79 = 7x+12x-3

-79 = 19x-3

-19x = 76

x = -4

Answer Link

clarch19 clarch19

07-01-2021

Answer:

x = -4

Step-by-step explanation:

7x + 3(4x) + 3(-1) = -79

7x + 12x - 3 = -79

19x - 3 = -79

19x = -76

x = -4

Answer Link

Otras preguntas

Why are biological macromolecules considered organic?

The most common subcutaneous mycosis in temperate regions is ________.

Antibodies are produced by ________. plasma cells T cells bone marrow Macrophages

jaundice (icterus) can be a result ofa. decreased amounts of conjugated bilirubin b. excessive amounts of glucuronic acidc. excessive amounts of unconjugated bi

The stalk of a leaf is known as the ________. petiole lamina stipule rachis

Cesium-137 has a half-life of about 30 years. Given this half-life, we can represent its decay with the exponential decay function A=A0e(ln(0.5)30)t If we begin

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

The ________ is the part of the body responsible for regulating body temperature.

(01.01 LC)Which of the following is only a muscle-strengthening activity that can be completed in school? Walking Dancing Martial arts Push-ups

The Fed targets a 2% inflation rate. Assume the growth rate of real GDP (Y) is 1.5% and the rate of change of the velocity of money (V) is constant. By how much