jls7281 jls7281
  • 08-01-2021
  • Biology
contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer
mathsbeginer mathsbeginer
  • 12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

Please help me pleasee
(2x + 2) – 3+ x – 10 How do I put this in the simplest form
Fiona shares an office with her exminus−husband. Her share of the rent and utilities is​ $625 per month. She is considering moving to a home office which she wi
Contemporary psychology continues to add breadth by adding topics and issues to its content to better understand human behavior. Which pair best represents this
Your company manufactures small kitchen appliances. It is introducing a new product line of appliances in designer colors with distinctive features for kitchens
Dan wants to replace the wooden floor at his gym. The floor is in the shape of a rectangle. Its length is 35 feet and its width is 20 feet. Suppose wood floorin
Which of the following locationd in a text are where you find clues to decipher the meaning of a word you dont know? Surrounding sentences Nearby words The inde
simplify 3 to the 2nd power times 3 to the third power. ​
if a child's shoe is 5 inches long, what is the approximate length in centimeters? (1 inch is about 2.54 centimeters)
25.0 g of mercury is heated from 25°C to 155°C, and absorbs 455 joules of heat in the process. Calculate the specific heat capacity of mercury.