elliebelly1260 elliebelly1260
  • 10-01-2021
  • Chemistry
contestada

A matrix made of wood is called a n____

Respuesta :

nghvbjy nghvbjy
  • 12-01-2021

Answer:

What is the matrix used in lithography? Lithography is a planographic or "flat surface" method that uses a stone slab matrix. Unlike relief and intaglio printing, the matrix used in lithography is completely flat. Serigraphy is also known as "silkscreen painting".

Explanation:

i looked it up

Answer Link

Otras preguntas

what is -5b = 7b + 36​
Predict the effect of aldosterone hypo secretion on body fluid pH.
WHen storm clouds ------------------------------- on the horizon, we hurry to find shelter. what is the missing word
Please help !!!!!!!!!!!!!!!
What is an ordered pair and why does that make the pair ordered?
Read the following passage and answer the question. At these words a black cloud of grief came shrouding over [him]. Both hands clawing the earth for dirt and g
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m
How are the neutral theory of molecular evolution and the molecular clock related?
If 3.0 grams of strontium-90 in a rock sample remained in 1989, approximately how many grams of strontium-90 were present in the original rock sample in 1933?
10. You used 8 cups of sugar while baking three dozen cookies and one cake. If you used 1.25 cups of sugar for the cake and the same amount of sugar for each do