lshadava lshadava

08-02-2021
Mathematics

contestada

What is the area of a rectangle whose width is 6 feet and length is 19 feet?

Respuesta :

Аноним Аноним

08-02-2021

Answer:

114

Step-by-step explanation:

A= length x width

A= 6x9

A=114

Answer Link

Otras preguntas

All of the following are common shapes of bacteria except rod spiral sphere square

· gangsterism· the eighteenth amendment· bootleggers· speakeasies all of these terms are associated with what era in american history?

Passé composé ou imparfait? Quand ma grand-mère _______ jeune, elle _______ en France. était / habitait était / a habité a été / a habité a été / habitait P

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Unknown element X is a metal that ionically bonds to sulfur. Is the formula, X3S feasible? Why or why not? A) It is feasible. The three metallic ions each rece

Who befriends Sirco when he is old and alone? A. su amo B. un niño C. el perro D. el lobo

Why might women be more effective spies than men

The length of a rectangle is four times it's width. If the area of the rectangle is 144 cm, find its perimeter

Confucius was born about 2,500 years ago in China and grew up in

help on number 2 and 3