ig8554 ig8554
  • 09-02-2021
  • Physics
contestada

+
1. Energy due to motion is
_______ energy

Respuesta :

ZyonReynolds
ZyonReynolds ZyonReynolds
  • 09-02-2021

Answer:

Kinetic energy

Explanation:

The energy associated with an object's motion is called kinetic energy. A speeding bullet, a walking person, and electromagnetic radiation like light all have kinetic energy.

Answer Link
Аноним Аноним
  • 09-02-2021

Kinetic energy. For example, a walking person.

Answer Link

Otras preguntas

In the lunchroom there were 100 milk cartons at lunch when lunch was over 88 had been purchased
What common North Carolina geological feature is pictured in the graphic below?
How does stock security help for the financial management of a country or company?​
AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of
Two letter boxes are given so you can try different arrangements of the letters in each box if you need to. Be sure to use a pencil with a good eraser
Where in California are most of our hydroelectric power generated?
Find the GFC of 16 and 80
Help plzzzChemistry assignment, need help.
An equation is shown. What is the value of m that makes the equation true? m − 3 [tex]\frac{1}{2}[/tex] = 5 [tex]\frac{2}{5}[/tex] Answer choices: 8 3/7 8 9/10
A breakfast on the menu for $7.25 actually costs $7.83, because of the sale tax. Which statements are correct for this situation