sarahbadawwy sarahbadawwy

09-03-2021
Health

contestada

Plz can u do the crossword puzzle
In return all my points I have

Plz can u do the crossword puzzle In return all my points I have class=

Plz can u do the crossword puzzle In return all my points I have class=

Respuesta :

elcq6240 elcq6240

11-03-2021

Answer:

8. Apple corer

22. Peeler

23. grater

24. spatula

Explanation:

all i can do at the moment sorry

Answer Link

Otras preguntas

What name is given to a form of counterconditioning that trains the client to maintain a state of relaxation in the presence of anxiety-inducing stimuli?

what's the Population of Australia?

Which is an appendicular bone?APEX A) Rib B) Radius C) Vertebra D) Cranium

Select the sentence that exhibits biased language. A. Being a waitress requires more skill than most people realize. B. Many pilots come to commercial airlines

Listeriosis is of particular concern for pregnant women since they are about ______ times more likely to get this infection than other healthy adults.

An organismâ€™s traits are determined by the specific combination of inherited _____. cells. genes. proteins. chromatids.

Which scientific concept did Charles Darwin and Alfred Wallace independently discover? mutation natural selection overbreeding sexual reproduction

A string with a mass of 8.00 g and a length of 5.00 m has one end attached to a wall; the other end is draped over a pulley and attached to a hanging object wit

Choose the point on the terminal side of -45° *will mark brainliest thank you!* A. (-3,-3) B.(4,-4) C.(5,5) D.(-2,2)

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is