masahamad masahamad

09-04-2021
Biology

contestada

Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine the mRNA and amino acid sequence for the below DNA sequence class=

Respuesta :

mariawaelramzy mariawaelramzy

09-04-2021

AUGAGCCCCGCUAGGUUCUC

Answer Link

Otras preguntas

who first use magical realism to describe the works of artists who put dreamlike images in their paintings

What are the minimum and maximum values

The part of an opera in which the music is speech-like, usually accompanied only by a harpsichord and moves the action forward is the:

Based on reading the excerpt from Silent Spring by Rachel Carson, what can you conclude was the author’s purpose?A. to entertain B. to inform C. to persuade

-2^2-3(-2)+1 evaluate the polynoimal

What is the UN purpose of the declaration of human rights

the decimal is 0.4what does 10x equal

The table below shows points on the graphs of functions f andgx f(x) g(x) -2 8 4-1 6 30 8 41 14

Describe three ways to avoid violence. I give 18 points please help me.

What are some ways that health care professionals can decrease the risk of drug abuse and addiction?