WoahItsBethanyH WoahItsBethanyH

07-05-2021
Mathematics

contestada

You stand 25 m from the base of a tree and the angle of elevation from the ground to the top of the tree is 48 degrees. How tall is the tree?

Respuesta :

zaydeenng zaydeenng

08-05-2021

Answer:

ffyftxrrxrrxcvcmuvcyztzxvujgyh

Step-by-step explanation:

✋☝☝✊✋❤❤❤

Answer Link

Otras preguntas

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

2. How many grams are in 5.125 moles of the following substances? Express your answer in grams a. Fe₂O₂? b. MgO? c. WCIĄ?

If you want to buy a $245,000 house with a 15% down payment, how much will you be borrowing from the bank? If the interest you will pay is $210,000 total, how m

The function w (t) = 29 + 0.0674t gives the estimated weight, in pounds, of a beaver t days after June 1, where t < 90. Which of the following is the best in

The graphs of lines f an g are shown on the grid. Write a system of equations to represent this graph.

Are 3x-2 and 3x2 reciprocals? Explain.

noah's family bought some fruit bars to put in the gift bags. They bought one box each of four flavors: apple, strawberry,blueberry,and peach

In your own words, what are the central themes of 1984? There are four. Use the context side on the picture

A linear relationship is given in the table. X-2 y-12-7-238 What is the slope of the relationship? 05 0-5 O -10 12 01/130 5 0_1 5

What was the Samurai equivalent in European Feudalism? a serf b noble c knight d king