elephantlover1288
elephantlover1288 elephantlover1288
  • 09-12-2021
  • Mathematics
contestada

can someone help with this ​

can someone help with this class=

Respuesta :

loneguy
loneguy loneguy
  • 09-12-2021

Answer:

B and C

Step-by-step explanation:

Answer Link

Otras preguntas

Our fingers have finger tips but our toes don't have toe tips yet we can still tip toe
minerals___. - can’t be compounds - are the same as rocks - can be gases - must be inorganic
Y+W-2asquared W=400 a=5 work out the value of y
A recipe calls for 3/4 cup of sugar. How many cups of sugar are needed to make the recipe 8 times?
help ! work needs to be shown on both (both, all three, however you’d like to refer it as)
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
Someone please Help me I need to write a fully detailed paragraph saying how meanders are formed please help I will mark it as. A brainliest answer
find the sum of the following 1982+773+548+1397​
movimiento ocurrido en 1976
Rodriguez Company completed its income statement and comparative balance sheet for the current year and provided the following information: Income Statement fo