Rxchbarbi3 Rxchbarbi3

08-02-2022
Mathematics

contestada

Is this pattern a net for the three-dimensional figure?

yes

No

Is this pattern a net for the threedimensional figure yes No class=

Respuesta :

08-02-2022

No it is not I think

Answer Link

RilakkuOats RilakkuOats

08-02-2022

No it is not

Have a good day

Answer Link

Otras preguntas

if the reactants contain 12 carbon atoms and four oxygen Atoms what must be true about the products

How the water cycle affects different earth spheres?

In the formation of Earth's atmosphere throughout its history, each of the following gases have, at one time or another, been the dominant gas in the atmospher

Peter make $7000 a month plus some money by commission rates.He gets 6% of everything he sells. If Peter sold 55000 worth of items this month, what is his salar

Arkensland is a highly industrialized country. Prices have been steadily increasing over the last few years and inflation reached an all-time high of 8 percent

Proponents of Popular Sovereignty believed that: A. All slaves should be declared free B. Southerners were too unreasonable for a fair debate on slavery C. Resi

A researcher is investigating motor ability by simultaneously studying three groups of youngsters: ages 6, 10, and 14 years. Which research strategy is the rese

what is sin-1(76/95)

As a criminal investigator in front of us there is a burned and suffocated body was found at sea . How do we know if this was abody suffocated before itwa crema

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?