djemdmd233y djemdmd233y
  • 10-02-2022
  • Geography
contestada

What country is by the location 60N-15E?

Respuesta :

dagreat1tony dagreat1tony
  • 10-02-2022
Europe. (It is in Sweden, near the town of Leksand)
Answer Link

Otras preguntas

Which of these leaders forced General Lee to surrender for the Confederate Army, ending the Civil War?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
The width of a rectangle is 2/5 its length. Find the dimensions if the perimeter is 42 meters. length = 13m, Width = 8m. not enough information. length = 15m, W
1.Which change occurred during world war i as a result of "total war"?A)Colonies In Africa and Asia gained their freedom from foreign rule.B)Democratic nation's
A and B share the cost in a ratio of 3:2. A pays £125 how much does b pay?
How did LBJ focus on the Civil Rights agenda during 1960’s?
The functional perspective of religion anthropology definition
Instead of starting with a blank PowerPoint presentation, you can use a __________. slide spreadsheet template transition
Given: ΔPSQ, PS = SQ PΔPSQ = 50 SQ – PQ = 1 Find: Area of ΔPSQ
Explain how heat transfer affects weather.