kaylyn05 kaylyn05
  • 09-06-2022
  • Mathematics
contestada

Answer 396,397,398,399

Answer 396397398399 class=

Respuesta :

superbrupakheti71
superbrupakheti71 superbrupakheti71
  • 09-06-2022

Answer:

yes you are right I think

Answer Link

Otras preguntas

Energy is stored long-term in the bonds of _____ and used short-term to perform work from a(n) _____ molecule. ATP : glucose an anabolic molecule : catabolic mo
Can anyone help me with this question ? 6c + 3 =45
Differentiate exogenous and endogenous pyrogens, and provide an example of each.
Read the sentence. The sun, a star at the center of our solar system, is made mostly of hydrogen and Which word or phrase is an appositive in the sentence? the
What is one important style decision that a speaker makes when writing a speech? A. The overall tone of the speech to engage the audience. B. The level of forma
The reaction of H2 with F2 produces HF with ΔH = –269 kJ/mol of HF. If the H–H and H–F bond energies are 432 and 565 kJ/mol, respectively, what is the F–F bond
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is
A radio station claims that the amount of advertising each hour has a mean of 15 minutes and a standard deviation of 2.9 minutes. You listen to the radio statio
How far apart are 27 and -57 on a number line
Old naval ships fired 10 kg cannon balls from a 240 kg cannon. It was very important to stop the recoil of the cannon, since otherwise the heavy cannon would go