ese1234 ese1234
  • 07-02-2017
  • English
contestada

how did jonathan swift label himself

Respuesta :

B1GPAP1
B1GPAP1 B1GPAP1
  • 07-02-2017
The answer is misanthrope.  But some say Swift does not hate or mistrust his fellowman rather he shows man’s flaws in an effort to correct them.  You cannot hate a person if what your intention is to make then see the error of their behavior.  A person hates or distrust would not do that.
Answer Link

Otras preguntas

sally made 10L of lemonade to sell for a fundraiser. if she puts 230ml of lemonade in each cup and sells each cup for fifty cents how much money can she make? h
What are the names of the Great Lakes? Are they salt water lakes or fresh water lakes? Are any of them connected to any of the oceans? Which state(s) borders th
Why urbanization occured during the industrial revolution?
Hey can you please help me posted picture of question
which statement best describes how mutations are related to evolution
Can you please help me with this English assignment! I need help!
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Help me please also thanks for the help
Decide whether to reject h 0 for the level of significance ΅ . right - tailed test z = 1.43 ΅ = 0.05 22) the p - value for a hypothesis test is p = 0.006. do yo
SOMEONEONE HELP ME OUT ...............