CheetaCupcake CheetaCupcake
  • 07-02-2017
  • Mathematics
contestada

What do they call the international, hula hoops championship?
Its for a math worksheet

Respuesta :

Pitxbullxgirl
Pitxbullxgirl Pitxbullxgirl
  • 07-02-2017
They call it the Whirl Series ^.^
Answer Link

Otras preguntas

What group of elements has the most stable arrangement in their outer energy level?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Monetary payment made by one ex-spouse to the other after a divorce is known as ________.
_____ authority stems from rules and regulations typically written down as laws, procedures, or codes of conduct.
Can you please help me with this one please
a garden is 82m long and 94m broad. a path 3m wide is to be built outsde and around it find the area of the path
what is the subject and verb The ripening tomatoes glistened on the sunny windowsill.
The sum of the squares of two consecutive odd positive integers is 74. Find the integers.
3+45456688888876777888888
​finn and glenda want to form and do business as hobby crafts corporation. a corporation is