HwBoss531 HwBoss531

08-02-2017
English

contestada

Which of the following brings your topic to a close?

immediately
beside
conversely
thus

Respuesta :

rowanleigh11 rowanleigh11

08-02-2017

i would think conversely

Answer Link

NerdT10 NerdT10

08-02-2017

Thus is a nice simple way to close your topic.

Answer Link

Otras preguntas

Which freedoms are guaranteed by the First Amendment? Select the three correct answers.\

In the so-called "state of nature", a time before governments existed that political scientists theorize about, individuals had which of the rights listed below

Why do we need a system for exchanging currencies between nations?

What is the sum of 3

Seven more than the quotient of a number and 3 equals 11

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Which of the following statements is true?A.Muslim and Hindu beliefs are quite different.B.Muslim and Hindu beliefs are partially related.C.Muslim and Hindu bel

How does respiration in plants and animals differ

if the guarantee against self incrimination were removed from the constitution, what might be the effect on the criminal justice system

PLEASE ANSWER ASAP!!!!!!!!!!! 25 POINTS!! Which of the following identifies the central l idea of the article “An Overview of the Great Depression"? a The Great