tasSyblassica tasSyblassica

10-05-2017
Arts

contestada

The taj mahal, not the hanging gardens, ______ built by shah jahan.

Respuesta :

ana618008 ana618008

13-05-2017

Was is the correct noun , instead of were.

Answer Link

Otras preguntas

Can I get some help? Thanks!

A. Match the following: _______ 1. Ella está muy -----. Su color no es bueno. _______ 2. El médico ---- a los pacientes _______ 3. Él también receta ----. _____

What are causes to the war with Britain

Please help ASAP will give good points an brainliest

Help graph the image

PLEASE HELP ASAP!!!!figure 1 is dilated to get figure 2. what is the scale factor? enter your answer in the box.

Which of the following terms describes the movement that was trying to get the Jews back to Palestine

What is the value of 6 if it the problem reads 0.679?

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

Find the distance between (−4, −6) and (−1, 2). *Please Check my answer*