CierraSp02212016 CierraSp02212016

08-06-2017
Biology

contestada

the most nutritious parts of grains such as rice and wheat are
A.endosprem
B.flower
C.stamen
D. embryo

Respuesta :

Аноним Аноним

08-06-2017

i think the answer is c

Answer Link

dhzilla dhzilla

08-06-2017

I also think it might be C

Answer Link

Otras preguntas

What was likely more important to Henry Wadsworth Longfellow about Paul revers ride the details of the ride or the way the ride made people feel? Guys please he

A 5.00 kg crate is on a 21.0 degree hill. Using X-Y axes tilted down the plane, what is the y-component of the weight?

Mya applied the distributive property to write the equivalent expressions below. 45 + 72 = 9 (5 + 9) What is Mya’s error? Mya did not write the common factor in

When Thomas Paine writes that "a government of our own is our natural right," what does he mean (Paine 38)?

Which statement is not true concerning chromosomes?

Do you know how to do this? If you do, please help!

Describe three important factors to consider when developing multicultural therapeutic communication skills. Explain how you will apply these skills on the job.

please help asap i have 2 days

the fact that the ratio of helium to hydrogen in the universe is so large (25%:75%) is evidence that group of answer choices the age of the universe is roughly

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha