misterwhale7196 misterwhale7196
  • 06-07-2017
  • Mathematics
contestada

What is the unit rate of 6840 customers in 45 days?

Respuesta :

xMinBrainlyx
xMinBrainlyx xMinBrainlyx
  • 10-07-2017
152 because:

6,840 customers ÷ 45 days = 152 costumers in 1 day


Hope this helps : )
Answer Link
slicergiza slicergiza
  • 29-08-2019

Answer:

Unit rate is 152 customers per day

Step-by-step explanation:

Given,

Total number of customers = 6840,

Time required for the customers = 45 days,

Therefore,

[tex]\text{Unit rate}=\frac{\text{Total number of customers}}{\text{Time required}}[/tex]

[tex]=\frac{6840}{45}[/tex]

[tex]=152\text{ customers per day}[/tex]

Answer Link

Otras preguntas

What was the main method used by the ku klux klan to restore white control in the south?
Which type of poem contains EXACTLY 17 syllables? A) an epic B) a haiku C) a ballad D) a sonnet Eliminate
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
After five men were caught breaking into the democratic campaign headquarters located in an apartment complex in washington, d.c. this scandal broke when the wh
Help please (1 3/4 - 1/8) + (5/6+ 2/3)
The childhood disorder that has been related to later antisocial personality disorder is
What is html and how does it work
what are some social changes that occurred in japan in the 1950s?
During the late 1800's many farmers supported increasing tariffs because
can someone please explan how I got this wrong? Solve for x in the triangleusing laws of cosine