khopatwork
khopatwork
07-02-2024
History
contestada
how many km is 99 dm
Respuesta :
taylorbeede7
taylorbeede7
07-02-2024
0.099 km is the answer
Answer Link
VER TODAS LAS RESPUESTAS ( 99+ )
Otras preguntas
This is a problem that I have to solve with matrixes, Please show me all of the work. I will award brainliest. At a particular swim meet, 10 points were awarded
While eating dinner marian are 25% of the apples slices she had in her bag she ate 5 apple slices in her bag how many apple slices did she have originally
The first side of a triangle is 9 meters shorter than the second side. The third side is 3 times as long as the first side. The perimeter is 39 meters. Find the
People reject the government's monopoly on violence, and claim the right for themselves, in a(n) ___. a. state. b. exercise of traditional authority. c. el
Which of these are symptoms of bipolar disorder? A. Changes in thoughts, feelings, or behavior B. Fears that that are difficult to control C. Extreme mood swing
On a biased dice, the probability of getting a 1 is 0.3 The dice is rolled 150 times How many one do you expect to roll?
A 10-year bond, with a par value equaling $1,000, pays 7% annually. If similar bonds are currently yielding 6% annually, what is the market value of the bond? U
Mother is m years old, and she is four times as old as her daughter. How much older is the mother than her daughter? Translate into Algebra (ANSWER ISNT M X 4
Which of the following does NOT belong to holding costs? A. order processing B. storage costs C. pilferage, scrap, and obsolescence D. insurance on inventory
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?
