lenoradaughtrep7r6u0 lenoradaughtrep7r6u0

09-04-2019
History

contestada

Explain the root of the conflict in Vietnam and identify why America got involved?

Respuesta :

emilyreams emilyreams

09-04-2019

The root of the conflict in Vietnam was communism. The north wanted it and the south didn't. America got involved because they were also against communism and they wanted to help southern Vietnam.

Answer Link

Otras preguntas

You have a 50-50 mixture of two normal distributions with the same standard deviation. How far apart do the means need to be in order for this distribution to b

A competitive firm will never choose to operate in which stage(s)? a) Stage iii only b) Stages i or iii c) Stages i or ii d) Stages ii or iii

The securities transactions, the ________ price is the price that the dealer receive when they sell the securities. a. bid b. askc. midpoint d. transaction

Positive integers B and C satisfy  CBB   .23 What is the value of C

A school has 960 students on its roll.One day,there was a flu epidemic and 22 1/2 % of the students were ill.How many students were ill?

Answer the questions please

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

give a reason why xylem vessel should be dead

retheefhh6thftyrfshgdebrtfgdf

Let a₁,a₂,a₃,⋯,a₁₀ be in G.P. with ai>0 for i=1,2,⋯,10 and S be the set of pairs (r,k),r,k∈N (the set of natural numbers) for which|logₑ aʳ₁aᵏ₂ logₑ aʳ₂aᵏ₃ l