jakyrachamp14 jakyrachamp14

09-12-2020
Mathematics

contestada

10 points
3. What is the slope of the line that passes through the points (2,6) and
(-2,5) ?
O A. undefined
O B. Zero
Oc. 114
OD. -1/4

Respuesta :

poojithanemala poojithanemala

09-12-2020

Answer:

I think u kept option incorrect but the correct answer is 1/4

Answer Link

Otras preguntas

In at least one hundred words, explain how the British used a multipronged approach—using ideological, economic, and military methods—in their colonization of A

Which level of ecological organization is referenced in this statement: In the clear water around the coral reef, clownfish could be seen swimming among the sti

What was a war crime committed by Japan? O A. The Pearl Harbor attack O B. The Battle of Iwo Jima O C. The Bataan Death March O D. The invasion of the Philippin

Add the following units a) 7/8 kilograms + 2/15 kilograms

What was the most taboo type of swearing during the Victorian era?

Which of the following statements is not a purpose of the United Nations as described in the United Nations Charter of 1945? A.To keep peace throughout the wo

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication

Choose three types of taxes local governments may impose. sales tax personal property real property estate tax

What happens to a plant that is planted in soil that does not drain water well such as clay? A)Nothing, plants are unaffected by how well the soil drains water

what is the Ka of a 1.5 M solution of HA that has a pH of 1.61