mkloveeie11 mkloveeie11

09-10-2021
Mathematics

contestada

Given f(x) = -x + 5, solve for 2 when f(x) = -10.

Respuesta :

lukasandrius09 lukasandrius09

09-10-2021

Answer:

15

Step-by-step explanation:

replace x with -10

Answer Link

Otras preguntas

I need help with an accounting course work for university who could help me?? I really need the help please or refer someone

Spread of agriculture around the world, how did the beginning of agriculture affect human civilization

What description below best defines fascism and its effects on its country and culture?A. An unforced philosophical view of authoritarian views that create a st

What is the range of function g if g(x) = f(x)+3?

give a reason why xylem vessel should be dead

Consider the temperature versus time graph below. A graph of temperature versus time has time on the horizontal axis and temperature in degrees Celsius from neg

Q4. Given the sets A = {0, 1, 4, 5} and B = {1, 4}: a. Draw a Venn diagram of A and B using the universal set U = {0, 1, 2, …, 8}. [1.25 mark] b. Graph A on the

¿Existen números imaginarios? ¿Cuál o cuáles?

19) Write the equation of any line that is perpendicular to the line with data table shown below. X -9 0 9 18 45 Y 2 4 6 8 14 020

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA