joannajepson11 joannajepson11

09-11-2021
Mathematics

contestada

Does anyone know the answer to this question?

Does anyone know the answer to this question class=

Respuesta :

rainlyyy1111 rainlyyy1111

09-11-2021

a) means what is the probability of P occurring once Q has occurred. That is 9/24 which is 3/8.

b) is 14/24 which is 7/12.

Please inform me if I gave you the correct answers :)

Answer Link

Otras preguntas

Kayla is playing with five numbers, arrange in no particular order, as picture below. What number would have to go in the missing space so that the average (me

Which is not associated with areas of karst topography?

với điều kiện nào của m thì phương trình ( 3m^2 - 4) x -1=m-x có nghiệm duy nhất?

company buys a toy for $1.50 and marks it up 70%. Find the markup.

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

The computer lab at a high school ordered 26 packages of Cra. There were 50 CDs in each packages. How many CDs did the computer ordered

If a(sub n)=24, which recursive formula could represent the sequence below? 24, 88, 664, 8408

what nation emerged from world war 1 as a strengthened world power

Whats the error? Tom has two pieces of wood to build a birdhouse. One is 3/4 yard long. The other piece is 4/8 yard long. Tom says both pieces of wood are the

It takes a total of 475 seconds for one technician to assemble one airrules smart phone, working alone. however, airrules manufactures its smart phones with twe